The Piltdown Man Hoax

At first, I read the book's definition of the Piltdown Man hoax but soon realized it would have to take more explaining than that, so I read the given materials. Throughout this weeks modules, I learned that in the early 1900s, there was a scientist who made a fake fossil claiming it was half man, half monkey. He did a number of things to disguise the skull of an orangutan to make it look like it had an ape's jaw and a human skull. The fossil looked older, so it was easily trusted by many communities and other scientists. After a few tests, forty years later, another scientist discovered that the hypothethis wasn't true. It was a real skull of an orangutan, however there was staining added to the fossil to make it look older, and the teeth were grinded down. During this time, this hoax was believed because it was seen as more evidence to complete Darwin's theory of humans and apes being related.

I think the Piltdown Man hoax could have been easily dissapproved  by scientists during this time but because they were confident in the findings and needed evidence to prove Darwin's theory, they settled for it. Every human has its faults, and in this case, the scientists had too much faith in the story. I am sure that during the forty years, other scientists thought of many ways to test and see if it was true or not, because that is what they did. Many people in the 1900's needed something to believe, in order to accept Charles Darwin's theory. Having too much confidence in something, or settling for less (which is demonstrated in the Piltdown Man hoax) impacts the scientific process.

Some positives in the Piltdown Man hoax could be the tests that proved the skull was not a humans. In revealing that the findings were bogus, methods of relative dating and chronometric dating were used. Professor Kenneth Oakley used fluorine analysis, a relative dating method to prove that the bone of the skull was not as old as people thought. The longer a bone lies in the earth, the more flourine it will have, and apparently, the skull did not contain enough to fit the description.

I don't think its possible or needed to remove the human error from science. If there are no humans to come up with the answers, methods, and questions to prove or dis prove a fact, then situations like the Piltdown Man could keep occurring. A life lesson learned from this is that, you can not trust anyone or everything you here. Until there are multiple tests or true evidence to prove something, don't trust it.

Homologous traits vs. Analogous traits

There are homologous traits in humans and cats; they share having an arm to perform movement. The forearm of a human, and the forearm of the cat (right above the paw) are identical to each other. As we know, humans walk upright on two feet and cats walk with four paws on the ground. Humans are able to communicate with words, have two hands, two feet. Cats have pointy ears, meow, and are taken care of by humans (usually).

In a cat the forearm helps the cat move and walk. In a human, the forearm allows the elbow to extend or fold. This homologous traits exist due to the environmental changes for the two mammals. The common ancestor looks like a cross between a panther and a squirell Its named, Dormaalocyon latouri. 

Sharks and penguins share analogous traits. Both are different considering, one is a bird and the other is a fish which results into two different environments. As shown below, a whale has a flipper located on the lateral side. A flipper helps to whale move in the ocean. A penguin possesses a wing, that also helps to bird move, except they fly instead of swim like a whale. The difference in environments for these two animals makes their wings and flippers analogous traits.

http://phenomena.nationalgeographic.com/2013/02/07/meet-the-ancestor-of-every-human-bat-cat-whale-and-mouse/

Protein Synthesis!

Ah... I remember this stuff from my freshman year in highschool for Biology. I was confused at first, then as I read the book and watched all videos, it all came back to me. I really hope I'm doing this correctly...

DNA STRAND CODE:

ATTGTACTAAGTAAGTGTTAGCTTGAATACTGAATATAACGCAATCGCCG

Good luck! :)

Historical Influences on Darwin

Alfred Russell Wallace and Charles Darwin have something in common, the thought of how evolution occurs. Both of these men were convinced that the process of evolution occurred by natural selection, where species live by adaption to environment. They shared the same interest in organisms, however were very different people. Charles Darwin discovered this theory at a very young age, and thought about it nearly twenty years before speaking up. After Alfred Wallace published an article presenting his ideas that were identical, Charles Darwin shot back and shared his ideas. I think Alfred Wallace was both a negative and positive influence on Darwin. In the beginning, he was a threat to Darwin, "stealing" his ideas, taking credit, but that influenced Darwin to present his theory. I think it gave him motivation to present his book, An Origin of Species. After that it was nothing but good for Darwin, his well-known theory is still around.

Alfred Russell Wallace posted an article that, "suggested species were descended from other species and that the appearance of new ones was influenced by environmental factors." (Introduction to Anthropology 37). By stating that a species was descended from another means that he believed in that reproduction must occur for natural selection. Also, Wallace states that a new appearance could mean a difference in the environment. This key point is listed in Darwin's simple explanation. 

People of the church were astonished with the publication of An Origin of Species. They were frightened because it eliminated the belief of a “greater purpose” in life and mortality. This created conflict between science and religion. Many debated over the theory with Darwinists, however this did not bother Darwin. During this time it was easy to become timid once religion was involved, so it was shocking that Charles Darwin still stood behind it. “Ideas spread and people began accepting natural selection as a valid scientific theory backed up by evidence.” (Darwin 200 par 23).

I believe that Charles Darwin needed Alfred Wallace in developing his theory, because he was the one who made him do it. If Wallace wasn't around to present the same ideas, I think Darwin would still have kept his ideas to himself. He might have been intimidated of Wallace since he had the same information. I think Darwin would be proud of himself today since the theory is still around and he’s the one who gets the most credit.

http://darwin200.christs.cam.ac.uk/pages/index.php?page_id=e6

What would you take if you were on a stranded island?

If I was stranded on an island and I could only bring 2 items, I would choose to take: a friend, and a dictionary.

I chose to bring a friend because I could imagine it getting lonely on a stranded island. Having someone else stranded with you would be a lot better, and easier to survive. Each person could combine their ideas to survive.

I chose to bring a dictionary because I'd probably get bored during the day, so why not learn some new words? After I was done with it, it could potentially turn into paper for the fire.